The Genomics Core (RDL) has offered quality sequencing to UTMB investigators for more than 13 years. It is our mission to offer quality DNA sequencing at an affordable price in an effort to further your research.
- ABI Prism™ 3100 DNA sequencers
- ≥1000bp read lengths @ ≥ 99.9% accuracy
- 48 hr turnaround time
- Universal primers provided (list)
- primer synthesis available
- Easy & flexible submission: (No DNA & primer premixing)
- Basecall quality (Q) scoring (Available)
List of Primers | Data Retrieval | Data Viewer Download 
Your data is stored in a directory corresponding to the PI name, on a computer called Genomics-S1 in UTMB-USERS-M domain in Network Neighborhood.
To access your data, you must have first given your UTMB-USERS-M username to the Genomics core in order to grant you privileges to the data. You will have to be logged into the UTMB-USERS-M domain in order to connect to the directory.
-
RIGHT Click on My network places and select "Search for Computers", type Genomics-S1 in the computer name, and click search now.
- Genomics-S1 will appear as a found computer.
- Double click to open, select your PI folder and given the correct permissions, you can then navigate to desired data. Copy the data to your hard drive or server storage.
Should you need further assistance, please call Lisa Pipper, ext. 26333 (lisa.pipper@utmb.edu) or
The data on Eoraptor will be available to you for approximately one month. After that time, if you have not retrieved your data, it may be deleted. Genomics Core is not responsible for deleted data.
| T7TA | aattaaccctcactaaaggg |
| T7pet | aaattaatacgactcactatagggg |
| T7BS | taatacgactcactatagggcg |
| T3 | aattgtaatacgactcactataggg |
| M13F | gccagggttttcccagtcacgac |
| T7term AS | gttatgctagttattgctcag |
| M13R | gaaacagctatgaccatgattacg |
| SP6 | atttaggtgacactatagaa |
- Opens chromatogram files from Applied Biosystems and Amersham MegaBace DNA sequencers.
- Opens SCF format chromatogram files created by ALF, Li-Cor, Visible Genetics OpenGene, Beckman CEQ 2000XL and CEQ 8000, and other sequencers.
- Save in SCF or Applied Biosystems format.
- Prints chromatogram with options to zoom or fit to one page.
- Exports sequences in plaint text or FASTA format.
- Copy the sequence to the clipboard in plain text or FASTA format for pasting into other applications.
- Reverse & complement the sequence and chromatogram.
- Search for sequences by exact matching or redundant codes.
Click here to download Chromas Lite (216kb). Windows 95/NT4.0 or higher is required. This is a self-extracting archive for Windows. Run the file and enter the name of the directory you wish to extract Chromas Lite to, or accept the default.
Chromas Lite is freeware and may be distributed without restriction provided that it is unmodified and is in the form of the installer downloaded from the link above.